View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532-Insertion-6 (Length: 184)
Name: NF0532-Insertion-6
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0532-Insertion-6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 7e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 8 - 184
Target Start/End: Original strand, 44696445 - 44696621
Alignment:
| Q |
8 |
gtgatgataacatgccattatgatgatggtcattatagcaattcaagccttccaatccttctttaccttttctaattgattctaaacctaaacccttatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44696445 |
gtgatgataacatgccattatgatgatggtcattatagcaattcaagccttctaatccttctttaccttttctaattgattctaaacctaaacccttatc |
44696544 |
T |
|
| Q |
108 |
ttcaaaccctaatcctatttgatggcagcttagtactgtttgtgaagaagaagctgaaattgggttttgacttacta |
184 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44696545 |
ttcaaaccctaatcctatttgagggcagcttagtactgtttgtgaagaagaagctgaaattgggttttgacttacta |
44696621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1194 times since January 2019
Visitors: 3642