View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532-Insertion-8 (Length: 143)
Name: NF0532-Insertion-8
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0532-Insertion-8 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 93; Significance: 1e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 43 - 143
Target Start/End: Original strand, 1169974 - 1170074
Alignment:
| Q |
43 |
tcctcgatctatctgtgttaatcaacatatgagtttaagtaagcaacaaaaactcttttttgaaggtaactcgcgacgtatctaaaccaaagacgtttta |
142 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1169974 |
tcctcgatctgtctgtgttaatcaacatatgagtttaagtaagcaacaaaaactcttttttgaaggtaactcgcaacgtatctaaaccaaagacgtttta |
1170073 |
T |
 |
| Q |
143 |
c |
143 |
Q |
| |
|
| |
|
|
| T |
1170074 |
c |
1170074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University