View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532_high_12 (Length: 397)
Name: NF0532_high_12
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0532_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 81 - 237
Target Start/End: Complemental strand, 34062706 - 34062548
Alignment:
Q |
81 |
ttctagcacaacaagcaagtttcagagagattcgtgttttgtgagaaactctctcaatgcaacaagaattttgcatttgatcattgatgagattgagaga |
180 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34062706 |
ttctagcacaacaagcaagtttcagagagattcgtgttttgtgagaaaccctctcaatgcaacaagaattttgcatttgatcattgatgagattgagaga |
34062607 |
T |
 |
Q |
181 |
gattcgtg--tgtggtttcataatcttttataccattcaacaatgaacatagtcttaat |
237 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
34062606 |
gattcgtgtgtgtggtttcataatcttttataccattcaacaatgaacctagtcttaat |
34062548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 308 - 369
Target Start/End: Complemental strand, 34062482 - 34062421
Alignment:
Q |
308 |
gaaaatcactaaatggctagacatcttatcgctatttctctttattctgtgttaaagctttt |
369 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34062482 |
gaaaatcactaaatggctagacatcttatcgctatttctctttattctgtgttaaagctttt |
34062421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 248 times since January 2019
Visitors: 3648