View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532_high_17 (Length: 360)
Name: NF0532_high_17
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0532_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 30 - 350
Target Start/End: Complemental strand, 31832547 - 31832227
Alignment:
| Q |
30 |
gtcccatgctattctccccaaaccactcttcttcaaggtctataaattaagtggcactcccaccaacactcttcacttcacacatcaaactaattgcttt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832547 |
gtcccatgctattctccccaaaccactcctcttcaaggtctataaattaagtggcactcccaccaacactcttcacttcacacatcaaactaattgcttt |
31832448 |
T |
 |
| Q |
130 |
tgtctctgactaccttcctttgactatcaaagtaatttcctttttcacattgctccttcgtttgaacgctaaagttcatatctttagcctaatttatgta |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
31832447 |
tgtctctgactaccttcctttgactatcaaagtaatttcctttttcacattgctccttcatttgaacgctaaagttcatatccttagccaaatttatgta |
31832348 |
T |
 |
| Q |
230 |
ctaaaatgtgttttaaggaaatgtcttattgttttcttttgtacattgaaacaggaaatggctttcattggcttggttttggtgtgttctcttactatgt |
329 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832347 |
ctaaaatgtgttttaaggaaatgtctcattgttttcttttgtacattgaaacaggaaatggctttcattggcttggttttggtgtgttctcttactatgt |
31832248 |
T |
 |
| Q |
330 |
tctcctctgtttatgcctatg |
350 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31832247 |
tctcctctgtttatgcctatg |
31832227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University