View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532_high_18 (Length: 345)
Name: NF0532_high_18
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0532_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 183 - 316
Target Start/End: Original strand, 43837043 - 43837176
Alignment:
Q |
183 |
tttgggagaaaagtagttaacctttagaaaggaaacattatggaaaaatatatatcatgatgccttgcttgagcattttcaaacattcttccgtgtcccc |
282 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43837043 |
tttgggagaaaagtagttaacctttagaaaggaaacattatggaaaaatatatatcaggatgccttgcttgagcattttcaaacattcttccgtgtcccc |
43837142 |
T |
 |
Q |
283 |
cacttttttgggtgatgcagatgtaatttagatt |
316 |
Q |
|
|
| |||||||||||||| ||||||||||||||||| |
|
|
T |
43837143 |
ctcttttttgggtgattcagatgtaatttagatt |
43837176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 183 - 316
Target Start/End: Original strand, 39871994 - 39872130
Alignment:
Q |
183 |
tttgggagaaaagtagtt---aacctttagaaaggaaacattatggaaaaatatatatcatgatgccttgcttgagcattttcaaacattcttccgtgtc |
279 |
Q |
|
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||| | | |||||||||||||||||||||||||| |||||| | || |
|
|
T |
39871994 |
tttgggagaaaagtagttgttaaccttcagaaaggaaacattatggaaaaatatatgttaggatgccttgcttgagcattttcaaactttcttcagcttc |
39872093 |
T |
 |
Q |
280 |
ccccacttttttgggtgatgcagatgtaatttagatt |
316 |
Q |
|
|
|||| |||||||||||||| ||||||||||||||||| |
|
|
T |
39872094 |
cccctcttttttgggtgatccagatgtaatttagatt |
39872130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University