View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532_high_25 (Length: 268)
Name: NF0532_high_25
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0532_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 30 - 234
Target Start/End: Original strand, 42600369 - 42600573
Alignment:
Q |
30 |
aggtggtttaagttttgatatgaatgagacaatatttgcatgaagtaaagtttatatttcaaatatgcatacgtaatgtgttgctattgtgatatttaag |
129 |
Q |
|
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
T |
42600369 |
aggtggtttaaattttgatctgaatgagacaatatttgcatgaagtaaagtttagatttcaaatatgcatacttaatgtgt--ctattgtgatatttaag |
42600466 |
T |
 |
Q |
130 |
gcatcattcatctctcttgcctcttgccctcgg--tatatgtatcggaccataaagggagtcaaaaatgatttcagatacataaaattaattttcacatg |
227 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42600467 |
gcatcattcatctctcttgcctcttgccctcggtatatatgtatcggaccataaagggaaccaaaaatgatttcagatacataaaattaattttcacatg |
42600566 |
T |
 |
Q |
228 |
tttaagt |
234 |
Q |
|
|
||||||| |
|
|
T |
42600567 |
tttaagt |
42600573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University