View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532_low_24 (Length: 347)
Name: NF0532_low_24
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0532_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 35993982 - 35994319
Alignment:
| Q |
1 |
aatcaaaactttaatgtgtatgaatgaaggttaaggttgcaaattgcaatggaagtaagagtgggagataatggtttttatagtgaagattagagtcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35993982 |
aatcaaaactttaatgtgtatgaatgaaggttaaggttgcaaattgcaatggaagtaagagtgggagataatggtttttatagtgaagattagagtcttt |
35994081 |
T |
 |
| Q |
101 |
aagtttggcagatttggtagtaatacgtctataagttgtaaaatacatcaagaaacttagttcaaccctataaaagttgttgcaccagatagttaattat |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35994082 |
aaggttggcagatttggtagtaatacgtctataagttgtaaaatacatcaagaaacttagttcaaccctataaaagttgttgcaccagatagttaattat |
35994181 |
T |
 |
| Q |
201 |
tttcatcaacgtttgcttctatctcaagtctttgtttagctagaggttgaattttcaaaaaagggtgattattgtgagactttgtcaagggaataagact |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35994182 |
tttcatcaacgtttgcttctatctcaagtctttgtttagctagaggttgaattttcaaaaaagggtgattattctgagactttgtcaagggaataagact |
35994281 |
T |
 |
| Q |
301 |
ttgttttaatttactttttctcacctcctttttcatct |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35994282 |
ttgttttaatttactttttctcacctcctttttcatct |
35994319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University