View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532_low_26 (Length: 328)
Name: NF0532_low_26
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0532_low_26 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 98 - 328
Target Start/End: Original strand, 46898168 - 46898398
Alignment:
| Q |
98 |
catggtacacaactctttccacttgatacctcttcttctttgctctcatactgacttgagcgtctcaacatccatatcggcagacactgttcatgctcgg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46898168 |
catggtacacaactctttccacttgatacctcttcctctttgctctcatactgacttgagcgtgtcaacatccatatcggcagacactgttcatgctcgg |
46898267 |
T |
|
| Q |
198 |
cccattgtttttgttcgattatgcctaaaaacacacttgattatattggtttnnnnnnncatgctagacctatgtcaaatcaccttgactacaaataact |
297 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46898268 |
cccattgtttttgttcgatcacgcctaaaaacacacttgattatattggtttaaaaaaacatgctagacctatgtcaaattaccttgactacaaataact |
46898367 |
T |
|
| Q |
298 |
tatcaatatcatacataggattcaaaacata |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46898368 |
tatcaatatcatacataggattcaaaacata |
46898398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 101 - 157
Target Start/End: Original strand, 32715228 - 32715284
Alignment:
| Q |
101 |
ggtacacaactctttccacttgatacctcttcttctttgctctcatactgacttgag |
157 |
Q |
| |
|
||||||||| || ||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
32715228 |
ggtacacaattccttccacttgatacctctcactctttgctctcatactaacttgag |
32715284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1222 times since January 2019
Visitors: 3642