View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532_low_30 (Length: 314)
Name: NF0532_low_30
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0532_low_30 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 94 - 314
Target Start/End: Complemental strand, 12635246 - 12635026
Alignment:
| Q |
94 |
gatacaggtttgaatcaaaggaacaatggtttgataaaatcaattttgacagcttctcatatcgtaagtgaccatgtttcaggaatcacattgtggcatt |
193 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12635246 |
gatacaggtttgaatcaaaggaacaatagtttgataaaatcaattttgacagcttctcatatcgtaagtgaccatgtttcaggaatcacattgtggcatt |
12635147 |
T |
|
| Q |
194 |
gtgtatcaactagcaaggtacttctttttacatagtaagatttacaccacacatggtcatgtagattagatcatttgcnnnnnnnnncttttctattctt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12635146 |
gtgtatcaactagcaaggtacttctttttacatagtaagatttacaccacacatggtcatgtagattagatcatttgctttttttttcttttctattctt |
12635047 |
T |
|
| Q |
294 |
taatctttagcttattcattt |
314 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
12635046 |
taatctttagcttattcattt |
12635026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 290 times since January 2019
Visitors: 3649