View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532_low_37 (Length: 275)
Name: NF0532_low_37
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0532_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 30 - 202
Target Start/End: Complemental strand, 42842238 - 42842067
Alignment:
Q |
30 |
gttcagaaccgaaccggtgcaatgtaactataacgggttttgtgttgtttcgcaaaaccattgtcaaatatgttgccgacgatctgatatatgacttata |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
42842238 |
gttcagaaccgaaccggtgcaatgtaactataacggattttgtgttgtttcgcaaaaccattgtcaaatatgttgccgacgatctgatata-gacttata |
42842140 |
T |
 |
Q |
130 |
aggaacttccacgagtgaacttttccggcgattaaaaccgccattgcttgtctttaaaaatggcacaacttaa |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42842139 |
aggaacttccacgagtgaacttttccggcgattaaaaccgccattgcttgtctttaaaaatggcacaacttaa |
42842067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University