View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0532_low_37 (Length: 275)

Name: NF0532_low_37
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0532_low_37
NF0532_low_37
[»] chr8 (1 HSPs)
chr8 (30-202)||(42842067-42842238)


Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 30 - 202
Target Start/End: Complemental strand, 42842238 - 42842067
Alignment:
30 gttcagaaccgaaccggtgcaatgtaactataacgggttttgtgttgtttcgcaaaaccattgtcaaatatgttgccgacgatctgatatatgacttata 129  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
42842238 gttcagaaccgaaccggtgcaatgtaactataacggattttgtgttgtttcgcaaaaccattgtcaaatatgttgccgacgatctgatata-gacttata 42842140  T
130 aggaacttccacgagtgaacttttccggcgattaaaaccgccattgcttgtctttaaaaatggcacaacttaa 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42842139 aggaacttccacgagtgaacttttccggcgattaaaaccgccattgcttgtctttaaaaatggcacaacttaa 42842067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University