View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0532_low_40 (Length: 268)

Name: NF0532_low_40
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0532_low_40
NF0532_low_40
[»] chr5 (1 HSPs)
chr5 (30-234)||(42600369-42600573)


Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 30 - 234
Target Start/End: Original strand, 42600369 - 42600573
Alignment:
30 aggtggtttaagttttgatatgaatgagacaatatttgcatgaagtaaagtttatatttcaaatatgcatacgtaatgtgttgctattgtgatatttaag 129  Q
    ||||||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||  |||||||||||||||||    
42600369 aggtggtttaaattttgatctgaatgagacaatatttgcatgaagtaaagtttagatttcaaatatgcatacttaatgtgt--ctattgtgatatttaag 42600466  T
130 gcatcattcatctctcttgcctcttgccctcgg--tatatgtatcggaccataaagggagtcaaaaatgatttcagatacataaaattaattttcacatg 227  Q
    |||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||    
42600467 gcatcattcatctctcttgcctcttgccctcggtatatatgtatcggaccataaagggaaccaaaaatgatttcagatacataaaattaattttcacatg 42600566  T
228 tttaagt 234  Q
    |||||||    
42600567 tttaagt 42600573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 415 times since January 2019
Visitors: 3650