View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532_low_42 (Length: 250)
Name: NF0532_low_42
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0532_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 33519610 - 33519366
Alignment:
Q |
1 |
aagttgagaggtagcattccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaa |
100 |
Q |
|
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33519610 |
aagtagagaggtagcaatccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaa |
33519511 |
T |
 |
Q |
101 |
cctaggcaactggctcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaaccttgccatcagaagagcggaaaaagtt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33519510 |
cctaggcaactggctcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaaccttgccatcagaagagcggaaaaagtt |
33519411 |
T |
 |
Q |
201 |
actaagaaagaacgatatagccattttcttttaattcatctcact |
245 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
T |
33519410 |
actaagaaagaacgatagagccattttcttttaattcatgtcact |
33519366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 33496346 - 33496521
Alignment:
Q |
1 |
aagttgagaggtagcattccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaa |
100 |
Q |
|
|
|||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||| |
|
|
T |
33496346 |
aagtagagaggtagcaatccttggcatagagagctccatagttattgatgccaatgaagtccaggctgcctcttaggagactcttctccttcgtagagat |
33496445 |
T |
 |
Q |
101 |
cctaggcaactggctcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaacctt |
176 |
Q |
|
|
| | |||||| || ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
33496446 |
ctttggcaaccggttcccaagaatagagcgcatctcagcagggtactcaccaaaaactaggggatctagtaacctt |
33496521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University