View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0532_low_42 (Length: 250)

Name: NF0532_low_42
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0532_low_42
NF0532_low_42
[»] chr2 (2 HSPs)
chr2 (1-245)||(33519366-33519610)
chr2 (1-176)||(33496346-33496521)


Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 33519610 - 33519366
Alignment:
1 aagttgagaggtagcattccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaa 100  Q
    |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33519610 aagtagagaggtagcaatccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaa 33519511  T
101 cctaggcaactggctcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaaccttgccatcagaagagcggaaaaagtt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33519510 cctaggcaactggctcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaaccttgccatcagaagagcggaaaaagtt 33519411  T
201 actaagaaagaacgatatagccattttcttttaattcatctcact 245  Q
    ||||||||||||||||| ||||||||||||||||||||| |||||    
33519410 actaagaaagaacgatagagccattttcttttaattcatgtcact 33519366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 33496346 - 33496521
Alignment:
1 aagttgagaggtagcattccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaa 100  Q
    |||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |  ||||     
33496346 aagtagagaggtagcaatccttggcatagagagctccatagttattgatgccaatgaagtccaggctgcctcttaggagactcttctccttcgtagagat 33496445  T
101 cctaggcaactggctcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaacctt 176  Q
    | | |||||| || ||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||    
33496446 ctttggcaaccggttcccaagaatagagcgcatctcagcagggtactcaccaaaaactaggggatctagtaacctt 33496521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6 times since January 2019
Visitors: 3646