View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532_low_44 (Length: 248)
Name: NF0532_low_44
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0532_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 5 - 237
Target Start/End: Complemental strand, 42824206 - 42823974
Alignment:
| Q |
5 |
ccataacatttatgctcacagcttggtggacttgaccctatcttgttgctgcttatcccaatatctctnnnnnnnnnnnnnnnnnataccacttctttca |
104 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42824206 |
ccataacacttgtgctcacagcttggtggacttgaccctatcttgttgctgcttatcccaatatctctatcatcatcat------ataccacttctttca |
42824113 |
T |
 |
| Q |
105 |
ttttctctgacttcatttaaaattcaactatttatttatatgttaattaagatatataataca----------tccaaatttacataatgttagaagaca |
194 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42824112 |
ttttctccgacttcatttaaaattcaagtatttat----atgttaattaagatatataatacaatacaatgcatccaaatttacataatgttagaagaca |
42824017 |
T |
 |
| Q |
195 |
caccttttttgactctatggtttggtgtggtgctggtgtctct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42824016 |
caccttttttgactctatggtttggtgtggtgctggtgcctct |
42823974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 6026218 - 6026174
Alignment:
| Q |
1 |
acaaccataacatttatgctcacagcttggtggacttgaccctat |
45 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6026218 |
acaatcatagcatttatgctcacagcttggtggacttgaccctat |
6026174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University