View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0532_low_48 (Length: 201)

Name: NF0532_low_48
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0532_low_48
NF0532_low_48
[»] chr1 (2 HSPs)
chr1 (10-103)||(35153830-35153925)
chr1 (19-94)||(27133561-27133630)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 35153925 - 35153830
Alignment:
10 aatatggtcgttagttttaaattaccatgcttagtaattaacttaatctgttttttaatgtgcatataatt--tatgttttaatcaacttcattct 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||    
35153925 aatatggtcgttagttttaaattaccatgcttagtaattaacttaatctgttttttaatgtgcatataatttatatgttttaatcaacttcattct 35153830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 27133630 - 27133561
Alignment:
19 gttagttttaaattaccatgcttagtaattaacttaatctgttttttaatgtgcatataatttatgttttaatcaa 94  Q
    ||||||||||||||||||| |||||||||| || |      ||  |||||||||||||||||||||||||||||||    
27133630 gttagttttaaattaccatacttagtaattcacat------ttaattaatgtgcatataatttatgttttaatcaa 27133561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 77 times since January 2019
Visitors: 3646