View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0536_low_3 (Length: 416)
Name: NF0536_low_3
Description: NF0536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0536_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 6e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 246 - 415
Target Start/End: Complemental strand, 732629 - 732460
Alignment:
| Q |
246 |
aagatttgatgatgtagagagcatttaggttggaattgttgacaggtgagccaacgaactttgcattgtgcacaaaataacctatgacaaacgggacact |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
732629 |
aagatttgatgatgtagagagcatttaggttggaattgttgacaggtgagccaacgaactttgcattgtgcacaaaataacctatgacaaacgggacact |
732530 |
T |
 |
| Q |
346 |
ctgtatgtatcacggtttcaaacctatcattgagcaaggaaactgaacaatcatagaatggacaattcac |
415 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
732529 |
atgtacgtatcacggtttcaaacctatcattgagcaacgaaactgaacaatcatagaatggacaattcac |
732460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University