View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0536_low_4 (Length: 319)
Name: NF0536_low_4
Description: NF0536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0536_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 102 - 232
Target Start/End: Complemental strand, 28664442 - 28664312
Alignment:
| Q |
102 |
tatatttatattacatcaaatactatattgcaagtcaatcatcatgcatgatacaacttgataatacactcacaaacttcaaaggtgaattattttctat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28664442 |
tatatttatattacatcaaatactatattgcaagtcaatcatcatgcatgatacaacttgataatacactcacaaacttcaaaggtgaattattttctat |
28664343 |
T |
|
| Q |
202 |
tacctttgtcggctgatcaagtaacatatct |
232 |
Q |
| |
|
| |||||||||||||||||||||| |||||| |
|
|
| T |
28664342 |
tgcctttgtcggctgatcaagtaaaatatct |
28664312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1143 times since January 2019
Visitors: 3663