View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0536_low_4 (Length: 319)

Name: NF0536_low_4
Description: NF0536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0536_low_4
NF0536_low_4
[»] chr1 (1 HSPs)
chr1 (102-232)||(28664312-28664442)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 102 - 232
Target Start/End: Complemental strand, 28664442 - 28664312
Alignment:
102 tatatttatattacatcaaatactatattgcaagtcaatcatcatgcatgatacaacttgataatacactcacaaacttcaaaggtgaattattttctat 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28664442 tatatttatattacatcaaatactatattgcaagtcaatcatcatgcatgatacaacttgataatacactcacaaacttcaaaggtgaattattttctat 28664343  T
202 tacctttgtcggctgatcaagtaacatatct 232  Q
    | |||||||||||||||||||||| ||||||    
28664342 tgcctttgtcggctgatcaagtaaaatatct 28664312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University