View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0536_low_5 (Length: 319)
Name: NF0536_low_5
Description: NF0536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0536_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 52 - 240
Target Start/End: Original strand, 13484164 - 13484352
Alignment:
| Q |
52 |
gatatctcattgcaacagtgtgtcatctcatgtacagaacagagagaggaaaaccaaagcagtgagtgagtgagtgttgattttgttgcttgtttgtcgt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13484164 |
gatatctcattgcaacagtgtgtcatctcatgtacagaacagagagaggaaaagcaaagcagtgagtgagtgagtgttgattttgttgcttgtttgtcgt |
13484263 |
T |
|
| Q |
152 |
ctttattcttccctttcattgttagctcgaaagaacttagaccccacaaatgtgttaaaagatttgcattattttatgctactacctct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13484264 |
ctttattcttccctttcattgttagctcgaaagaacttagaccccacaaatgtgttaaaagatttgcattattttatgctactatctct |
13484352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 965 times since January 2019
Visitors: 3660