View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_high_12 (Length: 309)

Name: NF0538_high_12
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_high_12
NF0538_high_12
[»] chr7 (2 HSPs)
chr7 (137-221)||(2479991-2480075)
chr7 (97-136)||(2480138-2480177)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 137 - 221
Target Start/End: Complemental strand, 2480075 - 2479991
Alignment:
137 caatttattgttgaagaaaggatacaaagtgttcatacctttctttagaaataccaatgtgagaacgtcaacctcattatgtgtt 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2480075 caatttattgttgaagaaaggatacaaagtgttcatacctttctttagaaataccaatgtgagaacgtcaacctcattatgtgtt 2479991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 2480177 - 2480138
Alignment:
97 ccaaaaagtaaaattaacatgtaagtagcatgagataaca 136  Q
    |||||||||||||||||||||||| |||||||||||||||    
2480177 ccaaaaagtaaaattaacatgtaaatagcatgagataaca 2480138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University