View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_high_19 (Length: 261)
Name: NF0538_high_19
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0538_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 40 - 239
Target Start/End: Complemental strand, 49230242 - 49230043
Alignment:
| Q |
40 |
gaacgcacacttgaatgaaagattgttgtgtgacaagtgtaagatagaaactccattttacttagaaaagtgagtgttgagcaaaatatttaagtaagat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49230242 |
gaacgcacacttgaatgaaagattgttgtgtgacaagtgtaagttagaaactccattttacttagaaaagtgagtgttgagcaaaatatttaagtaagat |
49230143 |
T |
|
| Q |
140 |
gaatcataaattcaatattttatgttaaaacataccgtctaactcacatgtatgattattcttgacaaaatgtgaatgattttttctttgaactgctctc |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
49230142 |
gaatcataaattcaatatcttatgttaaaacataacgtctaactcacacgtatgattattcttgacaaaatatgaatgattctttcttcgaactgctctc |
49230043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1837 times since January 2019
Visitors: 3673