View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_high_20 (Length: 252)
Name: NF0538_high_20
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0538_high_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 12 - 252
Target Start/End: Original strand, 43469317 - 43469557
Alignment:
| Q |
12 |
atgaaaataaacataaccaaaaccaatattttgtgtaactataaaaccatgtttagtctttacaaatgaatgaatcactcatcagaccctgtcaatacat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43469317 |
atgaaaataaacataaccaaaaccaatattttgtgtaactataaaaccatgtttagtctttacaaatgaatgaatcactcatcagaccctgtcaatacat |
43469416 |
T |
 |
| Q |
112 |
caaccataaccttcataacactcactctattttgcaaagacaatatgtaattagctgtctctctaaaaagtccatccaacccaatagattcatcactatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43469417 |
caaccataaccttcataacactcactctattttgcaaagacagtatgtaattagctgtctctctaaaaagtccatccaacccaatagattcatcactatt |
43469516 |
T |
 |
| Q |
212 |
tggtataagtctcttcaatgttctcacacgtctctgaattc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43469517 |
tggtataagtctcttcaatgttctcacacgtctctgaattc |
43469557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University