View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_high_22 (Length: 251)
Name: NF0538_high_22
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0538_high_22 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 146 - 251
Target Start/End: Original strand, 15112857 - 15112962
Alignment:
Q |
146 |
atatgagaatagtgtagttacttcgttcatctaataataactattagtaataagataaacaatagcatttcagtacgattacaacgactcaagctaaggt |
245 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||| |||||||| |||||||||||| | |
|
|
T |
15112857 |
atatgagaatagtgtagttacttcgttcatctaataataaatagtagtaataagataaacgatagcatttcagtatgattacaatgactcaagctaactt |
15112956 |
T |
 |
Q |
246 |
ttacta |
251 |
Q |
|
|
|||||| |
|
|
T |
15112957 |
ttacta |
15112962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University