View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_high_22 (Length: 251)

Name: NF0538_high_22
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_high_22
NF0538_high_22
[»] chr6 (1 HSPs)
chr6 (146-251)||(15112857-15112962)


Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 146 - 251
Target Start/End: Original strand, 15112857 - 15112962
Alignment:
146 atatgagaatagtgtagttacttcgttcatctaataataactattagtaataagataaacaatagcatttcagtacgattacaacgactcaagctaaggt 245  Q
    |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||| |||||||| ||||||||||||  |    
15112857 atatgagaatagtgtagttacttcgttcatctaataataaatagtagtaataagataaacgatagcatttcagtatgattacaatgactcaagctaactt 15112956  T
246 ttacta 251  Q
    ||||||    
15112957 ttacta 15112962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 135 times since January 2019
Visitors: 3674