View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_high_23 (Length: 251)
Name: NF0538_high_23
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0538_high_23 |
 |  |
|
[»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 251
Target Start/End: Original strand, 46377789 - 46378010
Alignment:
Q |
30 |
ctaggtgcactcgatccgtatccattggtaagcctgttttacattaaagaggaattgtttcagttttgctcacagttataaagcacctaagtctcaacat |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46377789 |
ctaggtgcactcgatccgtatccattggtaagcctgttttacattaaagaggaattgtttcagttttgctcacagttataaagcacctaagtctcaacat |
46377888 |
T |
 |
Q |
130 |
gtttaggaagtccataacttaagtgtcttcaaaatattttttgtgcagttcctccagcatattatgcacatttagcggcctttcgagcccgtttctatat |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46377889 |
gtttaggaagtccataacttaagtgtcttcaaaatattttttgtgcagttcctccagcatattatgcacatttagcggcctttcgagcccgtttctatat |
46377988 |
T |
 |
Q |
230 |
ggaaccagagatgcaagagaat |
251 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
46377989 |
ggaaccagagatgcaagagaat |
46378010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 170 - 226
Target Start/End: Original strand, 15412971 - 15413027
Alignment:
Q |
170 |
ttgtgcagttcctccagcatattatgcacatttagcggcctttcgagcccgtttcta |
226 |
Q |
|
|
|||||||||||||||||| |||||||||||| |||| || |||||||| |||||||| |
|
|
T |
15412971 |
ttgtgcagttcctccagcctattatgcacatctagcagcatttcgagcacgtttcta |
15413027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University