View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_high_24 (Length: 251)
Name: NF0538_high_24
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0538_high_24 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 24791006 - 24790784
Alignment:
Q |
29 |
atgatgttgatgatgacgacgaagatgaggatgaaaatggtgaccctttggaggaaaatgacgaattcaacgaagacaaaatgatgggtatgaagatttt |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24791006 |
atgatgttgatgatgacgacgaagatgaggatgaaaatggtgaccctttggaggaaaatgacgaattcaacgaagacaaaatgatgggtatgaagatttt |
24790907 |
T |
 |
Q |
129 |
gaaggtgaagcaaatggaagcattaatggaagaaatcttcgaaacggtgtcgtctatgaagagagcttatgtgaagttacaagaagcgcattcaccttgg |
228 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
24790906 |
gaaggttaagcaaatggaagcattaatggaagaaatcttcgaaacggtgtcttctatgaagagagcgtatgtgaagttacaagaagcgcattcaccttgg |
24790807 |
T |
 |
Q |
229 |
gatgcagagaagatgagggttgc |
251 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
24790806 |
gatgcagagaagatgagggttgc |
24790784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University