View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_high_24 (Length: 251)

Name: NF0538_high_24
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_high_24
NF0538_high_24
[»] chr3 (1 HSPs)
chr3 (29-251)||(24790784-24791006)


Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 24791006 - 24790784
Alignment:
29 atgatgttgatgatgacgacgaagatgaggatgaaaatggtgaccctttggaggaaaatgacgaattcaacgaagacaaaatgatgggtatgaagatttt 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24791006 atgatgttgatgatgacgacgaagatgaggatgaaaatggtgaccctttggaggaaaatgacgaattcaacgaagacaaaatgatgggtatgaagatttt 24790907  T
129 gaaggtgaagcaaatggaagcattaatggaagaaatcttcgaaacggtgtcgtctatgaagagagcttatgtgaagttacaagaagcgcattcaccttgg 228  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||    
24790906 gaaggttaagcaaatggaagcattaatggaagaaatcttcgaaacggtgtcttctatgaagagagcgtatgtgaagttacaagaagcgcattcaccttgg 24790807  T
229 gatgcagagaagatgagggttgc 251  Q
    |||||||||||||||||||||||    
24790806 gatgcagagaagatgagggttgc 24790784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University