View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_high_27 (Length: 232)
Name: NF0538_high_27
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0538_high_27 |
 | |
|
| [»] scaffold0172 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0172 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: scaffold0172
Description:
Target: scaffold0172; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 8478 - 8689
Alignment:
| Q |
1 |
tggtttatcccctaatgaaggcgaattcgattgttctgtgct-cctccacaaggtttcatgggtgatggcttagaagtttggccatttgcagaatgcaca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || | | ||| ||||||||||||||||||| |||||||||||||||||||||| |||||| ||| |
|
|
| T |
8478 |
tggtttatcccctaatgaaggcgaattcgattgttttgcgattcctgcacaaggtttcatgggtgacggcttagaagtttggccatttgaagaatggaca |
8577 |
T |
|
| Q |
100 |
tcagtaatctttccatttgactgtcctccatgactgttagaagttgctttctttacttcagaatgcaacggactcttcttagcgaatcttttgaaagtta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8578 |
tcagtaatctttccatttgactgtcctccatgactgttagaagttgctttctttacttcagaatgcaacggactcttcttagcgaatcttttgaaagtta |
8677 |
T |
|
| Q |
200 |
tcggctgatcat |
211 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8678 |
tcggctgatcat |
8689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 20 times since January 2019
Visitors: 3673