View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_high_9 (Length: 336)
Name: NF0538_high_9
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0538_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 98 - 285
Target Start/End: Complemental strand, 41658579 - 41658392
Alignment:
| Q |
98 |
atggccccaatcgcagaggccttagacctagcaatttctgctacatacctcagctctgaattatggttgactgcagtctgcagatcttaatctagaacta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41658579 |
atggccccaatcgcagaggccttagacctagcaatttctgctacatacctcagctctgaattatggttgactgcagtctgcagatcttaatctagaacta |
41658480 |
T |
|
| Q |
198 |
tagttggggtgatgtggttgtctttcaatgtatgtaaaatgtgattgatatgtgatatgatatatttctacttctgctttgatctgtg |
285 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41658479 |
tagttgggatgttgtggttgtctttcaatgtatgtaaaatatgattgatatgtgatatgatatatttctacttctgctttgatctgtg |
41658392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 208 - 283
Target Start/End: Complemental strand, 41657324 - 41657249
Alignment:
| Q |
208 |
gatgtggttgtctttcaatgtatgtaaaatgtgattgatatgtgatatgatatatttctacttctgctttgatctg |
283 |
Q |
| |
|
|||||||||||||||| | ||| || ||||||||| ||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
41657324 |
gatgtggttgtctttctaagtacgttaaatgtgatcgatatgtgatatgatatgtttctacttctgctgtgatctg |
41657249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1645 times since January 2019
Visitors: 3672