View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_29 (Length: 336)

Name: NF0538_low_29
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_29
NF0538_low_29
[»] chr1 (2 HSPs)
chr1 (98-282)||(41658395-41658579)
chr1 (208-282)||(41657250-41657324)


Alignment Details
Target: chr1 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 98 - 282
Target Start/End: Complemental strand, 41658579 - 41658395
Alignment:
98 atggccccaatcgcagaggccttagacctagcaatttctgctacatacctcagctctgaattatggttgactgcagtctgcagatcttaatctagaacta 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41658579 atggccccaatcgcagaggccttagacctagcaatttctgctacatacctcagctctgaattatggttgactgcagtctgcagatcttaatctagaacta 41658480  T
198 tagttggggtgatgtggttgtctttcaatgtatgtaaaatgtgattgatatgtgatatgatatatttctacttctgctttgatct 282  Q
    |||||||| || |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
41658479 tagttgggatgttgtggttgtctttcaatgtatgtaaaatatgattgatatgtgatatgatatatttctacttctgctttgatct 41658395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 208 - 282
Target Start/End: Complemental strand, 41657324 - 41657250
Alignment:
208 gatgtggttgtctttcaatgtatgtaaaatgtgattgatatgtgatatgatatatttctacttctgctttgatct 282  Q
    |||||||||||||||| | ||| || ||||||||| ||||||||||||||||| |||||||||||||| ||||||    
41657324 gatgtggttgtctttctaagtacgttaaatgtgatcgatatgtgatatgatatgtttctacttctgctgtgatct 41657250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1200 times since January 2019
Visitors: 3665