View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_29 (Length: 336)
Name: NF0538_low_29
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0538_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 98 - 282
Target Start/End: Complemental strand, 41658579 - 41658395
Alignment:
Q |
98 |
atggccccaatcgcagaggccttagacctagcaatttctgctacatacctcagctctgaattatggttgactgcagtctgcagatcttaatctagaacta |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41658579 |
atggccccaatcgcagaggccttagacctagcaatttctgctacatacctcagctctgaattatggttgactgcagtctgcagatcttaatctagaacta |
41658480 |
T |
 |
Q |
198 |
tagttggggtgatgtggttgtctttcaatgtatgtaaaatgtgattgatatgtgatatgatatatttctacttctgctttgatct |
282 |
Q |
|
|
|||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41658479 |
tagttgggatgttgtggttgtctttcaatgtatgtaaaatatgattgatatgtgatatgatatatttctacttctgctttgatct |
41658395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 208 - 282
Target Start/End: Complemental strand, 41657324 - 41657250
Alignment:
Q |
208 |
gatgtggttgtctttcaatgtatgtaaaatgtgattgatatgtgatatgatatatttctacttctgctttgatct |
282 |
Q |
|
|
|||||||||||||||| | ||| || ||||||||| ||||||||||||||||| |||||||||||||| |||||| |
|
|
T |
41657324 |
gatgtggttgtctttctaagtacgttaaatgtgatcgatatgtgatatgatatgtttctacttctgctgtgatct |
41657250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1200 times since January 2019
Visitors: 3665