View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_34 (Length: 323)
Name: NF0538_low_34
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0538_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 107 - 237
Target Start/End: Complemental strand, 45181023 - 45180898
Alignment:
Q |
107 |
ctctatagcctgtatatgattaactacaaaaggagaattttaattgataaataacaaagaggaatttttgttttgttttgttatgcttgtgatatcaggc |
206 |
Q |
|
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45181023 |
ctctataacctgtatatgattaactacaaaatgagaattttaattgataaataacaaagaggaatttttgttttgttttgttatgcttgtgatatcaggc |
45180924 |
T |
 |
Q |
207 |
attgtcttgtctgatccttatttccatgatt |
237 |
Q |
|
|
||| ||||||||||||||||||||||| |
|
|
T |
45180923 |
att-----gtctgatccttatttccatgatt |
45180898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 107 - 234
Target Start/End: Complemental strand, 45174078 - 45173957
Alignment:
Q |
107 |
ctctatagcctgtatatgattaactacaaaaggagaattttaattgataaataacaaagaggaatttttgttttgttttgttatgcttgtgatatcaggc |
206 |
Q |
|
|
||||||| || ||||||||||| |||| ||||||||| || |||||||||||| ||||||||| ||| ||| |||||||||||||||||||||||||| |
|
|
T |
45174078 |
ctctataacccgtatatgattacctaccaaaggagaaagttcattgataaataaaaaagaggaaatttaattt-gttttgttatgcttgtgatatcaggc |
45173980 |
T |
 |
Q |
207 |
attgtcttgtctgatccttatttccatg |
234 |
Q |
|
|
||| |||||||||||||||||||| |
|
|
T |
45173979 |
att-----gtctgatccttatttccatg |
45173957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University