View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_37 (Length: 309)
Name: NF0538_low_37
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0538_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 137 - 221
Target Start/End: Complemental strand, 2480075 - 2479991
Alignment:
Q |
137 |
caatttattgttgaagaaaggatacaaagtgttcatacctttctttagaaataccaatgtgagaacgtcaacctcattatgtgtt |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2480075 |
caatttattgttgaagaaaggatacaaagtgttcatacctttctttagaaataccaatgtgagaacgtcaacctcattatgtgtt |
2479991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 2480177 - 2480138
Alignment:
Q |
97 |
ccaaaaagtaaaattaacatgtaagtagcatgagataaca |
136 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
2480177 |
ccaaaaagtaaaattaacatgtaaatagcatgagataaca |
2480138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 628 times since January 2019
Visitors: 3654