View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_38 (Length: 305)
Name: NF0538_low_38
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0538_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 80 - 246
Target Start/End: Original strand, 1503950 - 1504108
Alignment:
| Q |
80 |
ttgaattgaaatgaatgtgactaatgattttggaattgagttgaatcagcagctcgatttaattcagttcatgaattatcaatgtcgtttccaaaagtat |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
1503950 |
ttgaattgaaatgaatgtgactaatgattttggaattgagttgaat---cagctcgatttaattcagctcatgaattatcaatgtcgttttcaaaagtat |
1504046 |
T |
|
| Q |
180 |
attctannnnnnnnnnagcaaaaatagcgttgacgtgcttagcttggttcgtatattcatctcactc |
246 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
1504047 |
attctatttttcttttagcaaaaatagcgttgacg-----cgcttggttcgtatattcatttcactc |
1504108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 90 times since January 2019
Visitors: 3674