View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_40 (Length: 300)
Name: NF0538_low_40
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0538_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 105 - 201
Target Start/End: Original strand, 14215698 - 14215798
Alignment:
| Q |
105 |
acctaatatattgtgcctgggcttttataaatagatagatatatttgctggaaattctgcccgttgatacttaagca----attggcctcaagcatgaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
14215698 |
acctaatatattgtgcctgggcttttataaatagatagatatatttgctggaaattctgcccattgatacttaagcaatatattggcctcaagcatgaat |
14215797 |
T |
|
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
14215798 |
a |
14215798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 46 - 97
Target Start/End: Original strand, 14215618 - 14215669
Alignment:
| Q |
46 |
agagacgtgattttcacaaactgataaatcctttgagatgtctctatccttt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14215618 |
agagacgtgattttcacaaactgataaatcctttgagatgtcgctatccttt |
14215669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 250 times since January 2019
Visitors: 3675