View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_41 (Length: 296)
Name: NF0538_low_41
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0538_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 74 - 240
Target Start/End: Original strand, 19903765 - 19903931
Alignment:
| Q |
74 |
actttctctaactgccacattctaaatactctcgaaggtccctttcttcccgtcaccgttcccttcgacacttccttgcgcggcgacaccgaagacttac |
173 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19903765 |
actttctctaactgccacattccaaatactctcgaaggtccctttcttcccgtcaccgttcccttcgacacttccttgcgcggcgacaccgaagacttac |
19903864 |
T |
|
| Q |
174 |
ccgacgatgatcctcgtgttcgccgtcaggtcaccggcttccagccagagcagatttcactttctct |
240 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19903865 |
ccgacgatgatccccgtgttcgccgtcaggtcaccggcttccagccagagcagatttcactttctct |
19903931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1051 times since January 2019
Visitors: 3662