View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_43 (Length: 290)

Name: NF0538_low_43
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_43
NF0538_low_43
[»] chr4 (1 HSPs)
chr4 (10-145)||(48181692-48181823)


Alignment Details
Target: chr4 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 10 - 145
Target Start/End: Complemental strand, 48181823 - 48181692
Alignment:
10 tttatttttctatatcttcaaccatannnnnnn--ccttatatttatatcttcttatcacattcacatctattacattattattctccttttctctttac 107  Q
    ||||||||||||||||||||||||||         |||||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||    
48181823 tttatttttctatatcttcaaccatatttttttttccttatatttatatcttcttatcacat------ctattacattattattctccttttctctttac 48181730  T
108 ctcaagttgtatgcatccaataaggtgcatggtgcaca 145  Q
    |||||||| |||||||||||||||||||||||||||||    
48181729 ctcaagttttatgcatccaataaggtgcatggtgcaca 48181692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 32 times since January 2019
Visitors: 3673