View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_43 (Length: 290)
Name: NF0538_low_43
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0538_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 10 - 145
Target Start/End: Complemental strand, 48181823 - 48181692
Alignment:
Q |
10 |
tttatttttctatatcttcaaccatannnnnnn--ccttatatttatatcttcttatcacattcacatctattacattattattctccttttctctttac |
107 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
48181823 |
tttatttttctatatcttcaaccatatttttttttccttatatttatatcttcttatcacat------ctattacattattattctccttttctctttac |
48181730 |
T |
 |
Q |
108 |
ctcaagttgtatgcatccaataaggtgcatggtgcaca |
145 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
T |
48181729 |
ctcaagttttatgcatccaataaggtgcatggtgcaca |
48181692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University