View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_54 (Length: 262)
Name: NF0538_low_54
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0538_low_54 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 103 - 262
Target Start/End: Complemental strand, 34676112 - 34675952
Alignment:
| Q |
103 |
taagatgcataatattgggaggtggttggaaaagaagttcctaggggcatttaaatttaaggagaagactaggg-agtctattaatgatgtgaatcatca |
201 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
34676112 |
taagatgcataatattgggaggtggtcggaaaagaagttcctaggggcatttaaatttaaggagaatactaggggagtctattaatgatgtgaatcatca |
34676013 |
T |
 |
| Q |
202 |
acacgtgtaaagaaatatttgtatcctaaaattgaaatgatagaataagggcaccacaaat |
262 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34676012 |
acacgtgtaaggaaatatttgtatcccaaaattgaaatgatagaataagggcaccacaaat |
34675952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 17 - 103
Target Start/End: Complemental strand, 34676452 - 34676366
Alignment:
| Q |
17 |
atcatcaataataggtaaatgattggaaatagattgacttgtgagatttcaaggaagttgcatagatcaaacacctaaagatttact |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34676452 |
atcatcaataataggtaaatgattggaaatagattgacttgtgagatttcaaggaagttgcatagatcaaacacctaaaaatttact |
34676366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University