View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_58 (Length: 251)
Name: NF0538_low_58
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0538_low_58 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 24790475 - 24790715
Alignment:
Q |
11 |
caaagggtcattgataatgtaccttgaattcctagtttcctcttagattgagtcctcccaggtttcttttcaccactagaaagagcaacaacaccttcaa |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24790475 |
caaagggtcattgataatgtaccttgaattcctagtttcctcttagattgagacctcccaggtttcttttcaccactagaaagagcaacaacaccttcaa |
24790574 |
T |
 |
Q |
111 |
gcttctctttcaaatccttcacttctaaatccttaaccttcacttcattcttcaactcctccaccaccgcttcatacggcgccacaacctccctcaccga |
210 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24790575 |
gtttctctttcaaatccttcacttctaaatccttaaccttcacttcattcttcaactcctccaccaccgcttcatacggcgccacaacctccctcaccga |
24790674 |
T |
 |
Q |
211 |
cgccacaccaaaacctcttctccgaccacctttcctgccac |
251 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24790675 |
cgccacaccaaaacctcttctccgaccacctttcctgccac |
24790715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1474 times since January 2019
Visitors: 3669