View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_70 (Length: 232)

Name: NF0538_low_70
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_70
NF0538_low_70
[»] scaffold0172 (1 HSPs)
scaffold0172 (1-211)||(8478-8689)


Alignment Details
Target: scaffold0172 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: scaffold0172
Description:

Target: scaffold0172; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 8478 - 8689
Alignment:
1 tggtttatcccctaatgaaggcgaattcgattgttctgtgct-cctccacaaggtttcatgggtgatggcttagaagtttggccatttgcagaatgcaca 99  Q
    ||||||||||||||||||||||||||||||||||| || | | ||| ||||||||||||||||||| |||||||||||||||||||||| |||||| |||    
8478 tggtttatcccctaatgaaggcgaattcgattgttttgcgattcctgcacaaggtttcatgggtgacggcttagaagtttggccatttgaagaatggaca 8577  T
100 tcagtaatctttccatttgactgtcctccatgactgttagaagttgctttctttacttcagaatgcaacggactcttcttagcgaatcttttgaaagtta 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8578 tcagtaatctttccatttgactgtcctccatgactgttagaagttgctttctttacttcagaatgcaacggactcttcttagcgaatcttttgaaagtta 8677  T
200 tcggctgatcat 211  Q
    ||||||||||||    
8678 tcggctgatcat 8689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University