View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_76 (Length: 214)

Name: NF0538_low_76
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_76
NF0538_low_76
[»] chr5 (1 HSPs)
chr5 (147-214)||(34675909-34675976)


Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 147 - 214
Target Start/End: Original strand, 34675909 - 34675976
Alignment:
147 agtgtatccaaatatattgctccttttgatatcatgcatgctaatttgtggtgcccttattctatcat 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34675909 agtgtatccaaatatattgctccttttgatatcatgcatgctaatttgtggtgcccttattctatcat 34675976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University