View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_82 (Length: 210)
Name: NF0538_low_82
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0538_low_82 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 32714487 - 32714374
Alignment:
| Q |
1 |
agtacctgttaaaaaagtagttagaaaaatgaacaatgtagtacaaaaactaagggcatggattgacatattatagcatatgtactagcataagtattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32714487 |
agtacctgttaaaaaagtagttagaaaaatgaacaatgtagtacaaaaaccaagggcatggattgacataatatagcatatgtactagcataagtattta |
32714388 |
T |
|
| Q |
101 |
tgatctgttcttat |
114 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
32714387 |
tgatatgttcttat |
32714374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1821 times since January 2019
Visitors: 3673