View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_83 (Length: 206)
Name: NF0538_low_83
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0538_low_83 |
 |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 20 - 176
Target Start/End: Complemental strand, 7247384 - 7247228
Alignment:
| Q |
20 |
acagcaaaaccaaaggtgcatggactaacatgcatttgaatttaattttttctttgtacattagtttatgaatttctgtaaaagatgtcagagacaaggg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7247384 |
acagcaaaaccaaaggtgcatggactaacatgcatttgcatttaattttttctttgtacattagtttatgaatttgtgtaaaagatgtcagagacaaggg |
7247285 |
T |
 |
| Q |
120 |
cagcagcagcaacaacaaaggcaggtgcagagnnnnnnncagaagcatcacaggttc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7247284 |
cagcagcagcaacaacaaaggcaggtgcagagaaaaaaacagaagcatcacaggttc |
7247228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 29 - 124
Target Start/End: Original strand, 25321379 - 25321474
Alignment:
| Q |
29 |
ccaaaggtgcatggactaacatgcatttgaatttaattttttctttgtacattagtttatgaatttctgtaaaagatgtcagagacaagggcagca |
124 |
Q |
| |
|
||||||||| |||||| |||||||||||||| || | ||||| |||||||||| || ||||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
25321379 |
ccaaaggtgaatggaccaacatgcatttgaaatttagtttttatttgtacatttattagtgaatttttgtaaaagatgttagagacaaaggcagca |
25321474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 29 - 124
Target Start/End: Complemental strand, 18505 - 18409
Alignment:
| Q |
29 |
ccaaaggtgcatggactaacatgcatttgaatttaattttttctttgtacattagtttatgaatttctgt-aaaagatgtcagagacaagggcagca |
124 |
Q |
| |
|
||||||||| |||||| |||||||||||||| || | |||||||||||||||| || ||||||| ||| |||||||||||| ||||| ||||||| |
|
|
| T |
18505 |
ccaaaggtgaatggaccaacatgcatttgaaatttagtttttctttgtacatttccttgtgaatttttgtaaaaagatgtcagtgacaaaggcagca |
18409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University