View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0538_low_89 (Length: 201)
Name: NF0538_low_89
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0538_low_89 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 6e-39; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 104 - 201
Target Start/End: Complemental strand, 32268091 - 32267994
Alignment:
| Q |
104 |
gaggcgtgttcttcaagattgcaccggctatagctattctggaatcttttcttttctatccaagtgtcaacatttccaacacttggatcttcaaaatg |
201 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32268091 |
gaggcttgttctccaagattgcaccggctatagctattctggaatcctttctttactatccaagtgtcaacatttccaacacttggatcttcaaaatg |
32267994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 121 - 200
Target Start/End: Original strand, 41889051 - 41889130
Alignment:
| Q |
121 |
attgcaccggctatagctattctggaatcttttcttttctatccaagtgtcaacatttccaacacttggatcttcaaaat |
200 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||| ||| |||||||||||| ||||| |||||| ||||||||||||||| |
|
|
| T |
41889051 |
attgcaccggctttagttatgctggaatcttttgtttactatccaagtgtgaacatatccaacttttggatcttcaaaat |
41889130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 201
Target Start/End: Original strand, 41901019 - 41901115
Alignment:
| Q |
105 |
aggcgtgttcttcaagattgcaccggctatagctattctggaatcttttcttttctatccaagtgtcaacatttccaacacttggatcttcaaaatg |
201 |
Q |
| |
|
|||| |||||| ||| |||||||||| ||||| ||||||||||| ||| ||| || ||||||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
41901019 |
aggcttgttctccaaaattgcaccggttatagttattctggaattatttgtttactgtccaagtgtcaacatttaaaacatttggatcttgaaaatg |
41901115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 121 - 199
Target Start/End: Original strand, 3438150 - 3438228
Alignment:
| Q |
121 |
attgcaccggctatagctattctggaatcttttcttttctatccaagtgtcaacatttccaacacttggatcttcaaaa |
199 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||||| | |||||||||||||| | | ||||| |||||||||||||| |
|
|
| T |
3438150 |
attgcaccggctatagttatgctgaaatcttttctctgttatccaagtgtcaatgtatacaacatttggatcttcaaaa |
3438228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 128 - 201
Target Start/End: Complemental strand, 547508 - 547435
Alignment:
| Q |
128 |
cggctatagctattctggaatcttttcttttctatccaagtgtcaacatttccaacacttggatcttcaaaatg |
201 |
Q |
| |
|
||||||||| ||| ||||||| | || |||| | |||||||| |||||| ||||||| || ||||||||||||| |
|
|
| T |
547508 |
cggctatagttatgctggaatatcttgttttttgtccaagtgccaacatatccaacatttagatcttcaaaatg |
547435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 131 - 196
Target Start/End: Original strand, 17627566 - 17627631
Alignment:
| Q |
131 |
ctatagctattctggaatcttttcttttctatccaagtgtcaacatttccaacacttggatcttca |
196 |
Q |
| |
|
|||||| ||||||||||| |||||||| |||||| ||||||| | ||||||| ||||||||||| |
|
|
| T |
17627566 |
ctatagttattctggaatattttctttgttatccatgtgtcaatgtatccaacatttggatcttca |
17627631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 197
Target Start/End: Original strand, 51763930 - 51764022
Alignment:
| Q |
105 |
aggcgtgttcttcaagattgcaccggctatagctattctggaatcttttcttttctatccaagtgtcaacatttccaacacttggatcttcaa |
197 |
Q |
| |
|
|||| ||| |||||| |||||| |||||||| ||| |||||||| ||| ||| ||||||| ||||||| ||| |||| |||||||||||| |
|
|
| T |
51763930 |
aggcttgtccttcaaatttgcacgggctatagttatgctggaatcatttgtttggtatccaactgtcaacgtttgaaacatttggatcttcaa |
51764022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1776 times since January 2019
Visitors: 3673