View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0539_low_14 (Length: 330)
Name: NF0539_low_14
Description: NF0539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0539_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 94 - 232
Target Start/End: Original strand, 51581519 - 51581657
Alignment:
Q |
94 |
tcgtgaagattctttagagtgaagaaatggcgtcaagcgaatctaattcacagatgaaggtcgtccatggcgatgctggttacatactcgaagacgttcc |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51581519 |
tcgtgaagattctttagagtgaagaaatggcgtcaagcgaatctaattcacagatgaaggtcgtccatggcgatgctggttacatactcgaagacgttcc |
51581618 |
T |
 |
Q |
194 |
tcatctctccgactacgttccaaatcttcctgtattttt |
232 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51581619 |
tcatctctccgactacgttccaaatcttcctgtattttt |
51581657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1057 times since January 2019
Visitors: 3662