View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0539_low_16 (Length: 318)
Name: NF0539_low_16
Description: NF0539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0539_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 96 - 237
Target Start/End: Complemental strand, 45868233 - 45868092
Alignment:
| Q |
96 |
attgctaaatgctgggagagaaattctcgcaaaagtttacgaattggtttttgaacaatatctcacataaaacaaacatccatcaccaccttattttcag |
195 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45868233 |
attgctaaatgccgagagagaaattctcgcaaaagtttacgaattggtttttgaacaatatctcacataaaacaaacatccatcaccaccttattttctg |
45868134 |
T |
|
| Q |
196 |
gaccaccagcacaaaagtaattttactctacatactatctct |
237 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45868133 |
ggccagcagcacaaaagtaattttactctacataccatctct |
45868092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 149 - 237
Target Start/End: Original strand, 7176227 - 7176315
Alignment:
| Q |
149 |
aacaatatctcacataaaacaaacatccatcaccaccttattttcaggaccaccagcacaaaagtaattttactctacatactatctct |
237 |
Q |
| |
|
|||| |||||||||||||||| |||||||| |||||||| |||| |||||| || ||||||| ||||||||||||||||||| ||||| |
|
|
| T |
7176227 |
aacagtatctcacataaaacacacatccattaccaccttgtttttcggaccagcaacacaaaaataattttactctacatactgtctct |
7176315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1154 times since January 2019
Visitors: 3663