View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0539_low_22 (Length: 300)
Name: NF0539_low_22
Description: NF0539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0539_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 72 - 136
Target Start/End: Original strand, 30794311 - 30794375
Alignment:
Q |
72 |
ttcttcgattgtaacacataatcacgtgatcccaaatgcgaagaaaaagtttgtctagatcgctc |
136 |
Q |
|
|
||||||||| |||||||||| ||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
30794311 |
ttcttcgatcgtaacacatagtcatgtgattccaaatgcgaagaaaaagtttgtctagatcgctc |
30794375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 175 - 236
Target Start/End: Original strand, 30794415 - 30794475
Alignment:
Q |
175 |
atcgtaattgaacacaatgcaatcgctaatcgttgattaaatcacaattatgaatctcctct |
236 |
Q |
|
|
||||||||||| |||| |||||| | |||||||| ||||||||||||||||||||||||||| |
|
|
T |
30794415 |
atcgtaattga-cacactgcaattggtaatcgttaattaaatcacaattatgaatctcctct |
30794475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University