View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0539_low_22 (Length: 300)

Name: NF0539_low_22
Description: NF0539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0539_low_22
NF0539_low_22
[»] chr1 (2 HSPs)
chr1 (72-136)||(30794311-30794375)
chr1 (175-236)||(30794415-30794475)


Alignment Details
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 72 - 136
Target Start/End: Original strand, 30794311 - 30794375
Alignment:
72 ttcttcgattgtaacacataatcacgtgatcccaaatgcgaagaaaaagtttgtctagatcgctc 136  Q
    ||||||||| |||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||    
30794311 ttcttcgatcgtaacacatagtcatgtgattccaaatgcgaagaaaaagtttgtctagatcgctc 30794375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 175 - 236
Target Start/End: Original strand, 30794415 - 30794475
Alignment:
175 atcgtaattgaacacaatgcaatcgctaatcgttgattaaatcacaattatgaatctcctct 236  Q
    ||||||||||| |||| |||||| | |||||||| |||||||||||||||||||||||||||    
30794415 atcgtaattga-cacactgcaattggtaatcgttaattaaatcacaattatgaatctcctct 30794475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University