View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0539_low_28 (Length: 237)
Name: NF0539_low_28
Description: NF0539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0539_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 4 - 166
Target Start/End: Complemental strand, 38228750 - 38228588
Alignment:
Q |
4 |
tgaatgaggcaactctgccatcaaatgtagtatagtgtttccaaagacatgttcttgtgaaaagaaagtatctttctctgccaacttgcaaacaaaatta |
103 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38228750 |
tgaatgaggcaactctgccaccaaatgtagtatagtgtttccaaagacatgttcttgtgaaaagaaagtatctttctctgccaacttgcaaacaaaatta |
38228651 |
T |
 |
Q |
104 |
aacacgcctctctgtctattcaagactacgtgaaaaagcacacttatctcattttcatcagca |
166 |
Q |
|
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
38228650 |
aacacgcctctctgtctatttaagactacgtgagaaagcacacttatctcattttcatcagca |
38228588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University