View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0539_low_31 (Length: 205)

Name: NF0539_low_31
Description: NF0539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0539_low_31
NF0539_low_31
[»] chr3 (1 HSPs)
chr3 (1-123)||(36467778-36467900)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 36467778 - 36467900
Alignment:
1 gttattctaatgggaacattattatgcgtcaattagtatgcaaaaagaagaatgcattgtaactatttggatgtctgctgtatggttatgtggattggtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36467778 gttattctaatgggaacattattatgcgtcaattagtatgcaaaaagaagaatgcattgtaactatttggatgtctgctgtatggttatgtggattggtt 36467877  T
101 gtgtgcgttttctacttggatct 123  Q
    |||||||||||||||||||||||    
36467878 gtgtgcgttttctacttggatct 36467900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University