View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0540_low_11 (Length: 301)
Name: NF0540_low_11
Description: NF0540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0540_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 96 - 270
Target Start/End: Original strand, 25378101 - 25378275
Alignment:
| Q |
96 |
accatgcatacacatctacaatcatacctaataagataaataagcaaaaacataggtcaattctaacttaactaaagtttaacaaccatttcggtctcac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25378101 |
accatgcatacacatctacaatcatacctaataagataaataagcaaaaacataggttaattctaacttaactaaagtttaacaaccatttcggtctcac |
25378200 |
T |
|
| Q |
196 |
aaaatctgagaaagttgtacgtaaaagatttagctgttcatttaagtctcaaaatcagagatgttggtattcaaa |
270 |
Q |
| |
|
|||||| |||||| || |||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25378201 |
aaaatccgagaaaattatacgtaaaagatttagttgttcatttaagtctcaaaatcagagatgtaggtattcaaa |
25378275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 25377994 - 25378069
Alignment:
| Q |
1 |
gatgtaacggaaaaggaaataaagaaaatttaatcacattaaatagcaacaatgcaatagctcagcactaaataac |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25377994 |
gatgtaacggaaaaggaaataaagaaaatttaatcacattaaatagcaacaatgcaatagcttagcactaaataac |
25378069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 516 times since January 2019
Visitors: 3651