View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_high_10 (Length: 350)
Name: NF0541_high_10
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0541_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 16 - 321
Target Start/End: Original strand, 5428749 - 5429054
Alignment:
| Q |
16 |
atgtgagcgagaatttgaagtttttcgagaagtttatgtttttcatcggattgggaactgggttcggtggtggaggtggtgtttttgcgggaagagcgac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5428749 |
atgtgagcgagaatttgaagtttttcgagaagtttatgtttttcatcggattgggaactgggttcggtggtggcggtggtgtttttgcgggaagagcgac |
5428848 |
T |
 |
| Q |
116 |
ggagggtggcggtgggaggggtttggggattttcggaattgttcaattcgagaagattgaggaaggattggattgtgatggtgatagattcgtagagaga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5428849 |
ggagggtggcggtgggaggggtttggggattttcggaattgttcaattcgagaagattgaggaaggattggattgtggtggtgatagattcgtagagaga |
5428948 |
T |
 |
| Q |
216 |
gggagggagtgaagaaatgagattggaagagggtttgattgaatgaattagggttttgagagaggatttagaggattttaaggttagggttgtggctaaa |
315 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5428949 |
gggagggagagaagaaatgagattggaagagggtttgattgaatgaattagggttttgagagaggatttagaggattttaaggttagggttgtggctaaa |
5429048 |
T |
 |
| Q |
316 |
gagatg |
321 |
Q |
| |
|
|||||| |
|
|
| T |
5429049 |
gagatg |
5429054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University