View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_high_27 (Length: 228)
Name: NF0541_high_27
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0541_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 52 - 199
Target Start/End: Original strand, 31196542 - 31196693
Alignment:
Q |
52 |
aaagaagccgtattgaaagttgaaacctataagtcaaacaacttaggcagttgggcgtgactatggatcccaagcttttttgagctacaattacagggag |
151 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
T |
31196542 |
aaagaagccgcattgaaagttgaaacctataagtcaaacaacttaggcagttgggcgtgactatggatcccaagcttttttgagctataattatagggag |
31196641 |
T |
 |
Q |
152 |
ctac----aagtgtcaaacatcaaaggacttcgaaaacttacacatccaaat |
199 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
31196642 |
ctacaagtaagtgtcaaacatcaaaggacttcgaaaacttacacattcaaat |
31196693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University