View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_high_32 (Length: 227)
Name: NF0541_high_32
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0541_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 45345256 - 45345166
Alignment:
Q |
1 |
acaggctgcttctttgatgcccatgagactgctccaccagacagtaaaaatacataaccggatgtgcttcttctatcatcaatatctccag |
91 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||||||||||||||| |
|
|
T |
45345256 |
acaggctgcttctttgatgcccatgagactgctccaccagacagtaaaaatacataatcggatgtggtccttctatcatcaatatctccag |
45345166 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University