View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_high_34 (Length: 220)
Name: NF0541_high_34
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0541_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 15753939 - 15754117
Alignment:
| Q |
1 |
actttggtaggatttcaagtattgagagtaaatcaagtcatccagtggcaggtgcactagtggactatgcaaggttgcactctatcaaaccagtcccaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15753939 |
actttggtaggatttcaagtattgagagtaaatcaagtcatccagtggcaggtgcactagtggattatgcaaggttgcactctatcaaaccagtcccaga |
15754038 |
T |
|
| Q |
101 |
aaatgtggagaattttcaaaattttccaggggaaggaatttttggtacaattgatggtagagatatctatataggaaac |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15754039 |
aaatgtggagaattttcaaaattttccaggggaaggaatttttggtacgattgatggtagagatatctatataggaaac |
15754117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1662 times since January 2019
Visitors: 3672