View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0541_low_14 (Length: 359)
Name: NF0541_low_14
Description: NF0541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0541_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 30652779 - 30652586
Alignment:
| Q |
13 |
aatatctcaacaaaaagagtagatctgtgttgtgagttgtgattaaacaaaaggatatgaaacgtgatggagaaattttagaagtggtgctgggtggaaa |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30652779 |
aatatctcaacaaaaagagtagagctgtgttgtgaggtgtgattaaacaaaaggatatgaaacgtgatggagaaattttagaagtggtgctgggtggaaa |
30652680 |
T |
|
| Q |
113 |
acaatcaaagggctcctagtctctttagcaaaacggttatcaaacacataatgcacaaaatggctaaaaagaaggaaacaaatgacaaccacgt |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30652679 |
acaatcaaagggcttctagtctctttagcaaaacggttatcaaacacataatgcacaaaatggctaaaaagaaggaaacaaatgacaaccacgt |
30652586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1224 times since January 2019
Visitors: 3665